ID: 996549123_996549126

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 996549123 996549126
Species Human (GRCh38) Human (GRCh38)
Location 5:124711827-124711849 5:124711847-124711869
Sequence CCAGGCTAAGAATCTGGGGGGTT GTTATTATGAAGTTGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 1, 1: 0, 2: 1, 3: 15, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!