ID: 996555733_996555737

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 996555733 996555737
Species Human (GRCh38) Human (GRCh38)
Location 5:124777323-124777345 5:124777339-124777361
Sequence CCACAGGGAACTAGATTATCTAG TATCTAGAGAAGGCCGGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 71, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!