ID: 996558903_996558906

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 996558903 996558906
Species Human (GRCh38) Human (GRCh38)
Location 5:124807728-124807750 5:124807777-124807799
Sequence CCATAGCTTTCCCTAGGATTGGA ATGTCCTAATTTAAGATCTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!