ID: 996591189_996591194

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 996591189 996591194
Species Human (GRCh38) Human (GRCh38)
Location 5:125149532-125149554 5:125149569-125149591
Sequence CCGCCACATTTGAAGAACCACAA AGCTGAAAGAAATACACAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 144} {0: 1, 1: 0, 2: 3, 3: 29, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!