ID: 996633472_996633476

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 996633472 996633476
Species Human (GRCh38) Human (GRCh38)
Location 5:125664612-125664634 5:125664632-125664654
Sequence CCAGTCTATAGGAGCCATCTGAT GATTTTTTAATTGGGAGAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 46, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!