ID: 996714921_996714928

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 996714921 996714928
Species Human (GRCh38) Human (GRCh38)
Location 5:126579400-126579422 5:126579431-126579453
Sequence CCACCATCCTACCGTTTACTCCC CTTACCATGCTGGATTATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 180} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!