ID: 996738186_996738191

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 996738186 996738191
Species Human (GRCh38) Human (GRCh38)
Location 5:126776642-126776664 5:126776670-126776692
Sequence CCACGCCCGCGGTGGCCGGGGAC GAGTTTCGCGTGTGGCTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146} {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!