ID: 996769469_996769473 |
View in Genome Browser |
Spacer: 23 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 996769469 | 996769473 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:127071039-127071061 | 5:127071085-127071107 |
| Sequence | CCAACCTCCCTTCAGGGACACTA | CTGAGCATTTGCAATGTGCCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 6, 2: 82, 3: 573, 4: 2326} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||