ID: 996792448_996792463

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 996792448 996792463
Species Human (GRCh38) Human (GRCh38)
Location 5:127307293-127307315 5:127307345-127307367
Sequence CCCTGTGAACTTGACTAGGGAGC GCAGCTGAGTGGTGAGAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 31, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!