ID: 996794090_996794092

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 996794090 996794092
Species Human (GRCh38) Human (GRCh38)
Location 5:127325357-127325379 5:127325388-127325410
Sequence CCTTAGATCTTTAATGAGTATTG TTTTTTCCCTCATATGTTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 47, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!