|
Left Crispr |
Right Crispr |
| Crispr ID |
996794440 |
996794446 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:127329856-127329878
|
5:127329897-127329919
|
| Sequence |
CCAGAGGCTGCAGGAGTGCCTGT |
ATTACAGGTGTTACACACCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 6, 3: 38, 4: 329} |
{0: 1, 1: 0, 2: 2, 3: 31, 4: 802} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|