ID: 996801924_996801927 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 996801924 | 996801927 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:127413753-127413775 | 5:127413788-127413810 |
| Sequence | CCTCCAAAGTGCTCTAGCTTCCT | AAATTGCAGAATACTAATTTTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 5, 3: 33, 4: 396} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||