ID: 996801924_996801927

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 996801924 996801927
Species Human (GRCh38) Human (GRCh38)
Location 5:127413753-127413775 5:127413788-127413810
Sequence CCTCCAAAGTGCTCTAGCTTCCT AAATTGCAGAATACTAATTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 156} {0: 1, 1: 0, 2: 5, 3: 33, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!