ID: 996819588_996819593

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 996819588 996819593
Species Human (GRCh38) Human (GRCh38)
Location 5:127611804-127611826 5:127611850-127611872
Sequence CCAGGAATTCTGGGTTGGCCATA TGTCCTAGTGGAGATGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 111} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!