ID: 996825560_996825566

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 996825560 996825566
Species Human (GRCh38) Human (GRCh38)
Location 5:127677806-127677828 5:127677854-127677876
Sequence CCTGCCATCTTCTGCAGATAATT GGCCTGTTATTGGACTTCGGTGG
Strand - +
Off-target summary {0: 6, 1: 195, 2: 195, 3: 114, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!