ID: 996825674_996825685

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 996825674 996825685
Species Human (GRCh38) Human (GRCh38)
Location 5:127678627-127678649 5:127678672-127678694
Sequence CCCTGTCATCACTGAATGGGCCC CAGGGATGGAAGTTATGCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!