ID: 996862770_996862773

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 996862770 996862773
Species Human (GRCh38) Human (GRCh38)
Location 5:128084104-128084126 5:128084119-128084141
Sequence CCGGGACGGCGGCGGGGTCCGCG GGTCCGCGATGAGGGCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 243} {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!