|
Left Crispr |
Right Crispr |
| Crispr ID |
996902316 |
996902321 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:128556525-128556547
|
5:128556564-128556586
|
| Sequence |
CCAAACACTGCATGTTCTCACTC |
CAATGAGAACAGCTGGACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4435, 1: 11380, 2: 17706, 3: 10546, 4: 8009} |
{0: 1, 1: 15, 2: 674, 3: 21435, 4: 15750} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|