ID: 996902316_996902321

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 996902316 996902321
Species Human (GRCh38) Human (GRCh38)
Location 5:128556525-128556547 5:128556564-128556586
Sequence CCAAACACTGCATGTTCTCACTC CAATGAGAACAGCTGGACCCAGG
Strand - +
Off-target summary {0: 4435, 1: 11380, 2: 17706, 3: 10546, 4: 8009} {0: 1, 1: 15, 2: 674, 3: 21435, 4: 15750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!