ID: 996906691_996906698

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 996906691 996906698
Species Human (GRCh38) Human (GRCh38)
Location 5:128608971-128608993 5:128609020-128609042
Sequence CCCACAGTCACTGTGCTGTTCTT TCTGCCATGCAGCTGCTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 372} {0: 1, 1: 1, 2: 4, 3: 63, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!