ID: 996919704_996919707

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 996919704 996919707
Species Human (GRCh38) Human (GRCh38)
Location 5:128753487-128753509 5:128753519-128753541
Sequence CCTTGCTCAAAGTGCCCAGCTTC CAGTTTTCTCATACATAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 209} {0: 1, 1: 2, 2: 71, 3: 585, 4: 2696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!