ID: 996926251_996926253

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 996926251 996926253
Species Human (GRCh38) Human (GRCh38)
Location 5:128829980-128830002 5:128830000-128830022
Sequence CCAAAGCAGAGTAGTGGTACAAA AAACATGGACTGCTTTTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118} {0: 1, 1: 0, 2: 0, 3: 20, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!