ID: 996978276_996978280

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 996978276 996978280
Species Human (GRCh38) Human (GRCh38)
Location 5:129460312-129460334 5:129460327-129460349
Sequence CCGGGGAGGCCGCTGCGCCCCGG CGCCCCGGAGTGGATCGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 319} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!