ID: 997001363_997001372

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 997001363 997001372
Species Human (GRCh38) Human (GRCh38)
Location 5:129766069-129766091 5:129766097-129766119
Sequence CCTTCCATTGTCTGCAGATACCT CATGGTTGTAGACACAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 381} {0: 1, 1: 0, 2: 0, 3: 13, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!