|
Left Crispr |
Right Crispr |
| Crispr ID |
997022146 |
997022151 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:130014299-130014321
|
5:130014345-130014367
|
| Sequence |
CCCACTCCTGGTACCAATTTACT |
TATGAAGAAATACCCAAAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 163, 1: 305, 2: 414, 3: 457, 4: 541} |
{0: 1, 1: 36, 2: 515, 3: 1172, 4: 3219} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|