|
Left Crispr |
Right Crispr |
Crispr ID |
997022150 |
997022151 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:130014330-130014352
|
5:130014345-130014367
|
Sequence |
CCATTTTCATGCTGCTATGAAGA |
TATGAAGAAATACCCAAAAGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 38, 1: 668, 2: 1158, 3: 2367, 4: 3574} |
{0: 1, 1: 36, 2: 515, 3: 1172, 4: 3219} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|