ID: 997050449_997050457

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 997050449 997050457
Species Human (GRCh38) Human (GRCh38)
Location 5:130373868-130373890 5:130373912-130373934
Sequence CCCGCTAAAATTCATATATTGAA GTATTAGGAGGTGAGGACTTTGG
Strand - +
Off-target summary No data {0: 9, 1: 63, 2: 531, 3: 1476, 4: 2663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!