ID: 997065444_997065452

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 997065444 997065452
Species Human (GRCh38) Human (GRCh38)
Location 5:130554184-130554206 5:130554212-130554234
Sequence CCCCTCAATTTGCATTGACCCAC AATTTGCCTGTAAGTGAAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 35, 3: 123, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!