ID: 997121873_997121875

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 997121873 997121875
Species Human (GRCh38) Human (GRCh38)
Location 5:131182807-131182829 5:131182856-131182878
Sequence CCTAATACTCCTAGTAGAAGTTT TTCCTATATATTATGTATTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 40, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!