ID: 997157795_997157798

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 997157795 997157798
Species Human (GRCh38) Human (GRCh38)
Location 5:131577398-131577420 5:131577436-131577458
Sequence CCTCAAGAAGCTACAGGGTATAG ATATGGATGTACCTTCTTGTTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 10, 3: 56, 4: 249} {0: 2, 1: 0, 2: 3, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!