ID: 997177610_997177617

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 997177610 997177617
Species Human (GRCh38) Human (GRCh38)
Location 5:131796328-131796350 5:131796375-131796397
Sequence CCTCCAGCCTTCTCTCAACTCAG CTCCACAACGCCAACGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 380} {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!