ID: 997242205_997242213

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 997242205 997242213
Species Human (GRCh38) Human (GRCh38)
Location 5:132315655-132315677 5:132315703-132315725
Sequence CCATGGAAGATCAGTCAAGCCAG GCAGCAGCCTCGCTATCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 145} {0: 1, 1: 0, 2: 0, 3: 20, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!