ID: 997258047_997258061

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 997258047 997258061
Species Human (GRCh38) Human (GRCh38)
Location 5:132444252-132444274 5:132444299-132444321
Sequence CCGGCTGGGCTTCACACCAGTAG CTCAGCTTATGCTGAACTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 114} {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!