|
Left Crispr |
Right Crispr |
Crispr ID |
997264115 |
997264122 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:132485153-132485175
|
5:132485168-132485190
|
Sequence |
CCACCCACCTTCGCCTTCCAAAG |
TTCCAAAGTGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043} |
{0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|