|
Left Crispr |
Right Crispr |
| Crispr ID |
997264115 |
997264124 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:132485153-132485175
|
5:132485187-132485209
|
| Sequence |
CCACCCACCTTCGCCTTCCAAAG |
CAGGCATGAGCCACTGCCCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 1069, 2: 27256, 3: 105944, 4: 184043} |
{0: 242, 1: 13590, 2: 54236, 3: 120792, 4: 147671} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|