ID: 997265169_997265184

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 997265169 997265184
Species Human (GRCh38) Human (GRCh38)
Location 5:132490981-132491003 5:132491022-132491044
Sequence CCGGGGCCACCGCGGGCCCGCCC CCCTGCTCCGGCTTGCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 504} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!