ID: 997282260_997282281

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 997282260 997282281
Species Human (GRCh38) Human (GRCh38)
Location 5:132656507-132656529 5:132656553-132656575
Sequence CCAGCGCCTTCTCCCACGCGCGG GGCAGGGCTTTTGGTGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135} {0: 1, 1: 0, 2: 2, 3: 33, 4: 608}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!