ID: 997284071_997284085

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 997284071 997284085
Species Human (GRCh38) Human (GRCh38)
Location 5:132665812-132665834 5:132665851-132665873
Sequence CCCTTCCCAGCACTCACGGGTGG GAGGCCACGGCAAGGGCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 43, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!