ID: 997303410_997303416

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 997303410 997303416
Species Human (GRCh38) Human (GRCh38)
Location 5:132822781-132822803 5:132822796-132822818
Sequence CCTCTCCACCTATAACTATGTAA CTATGTAAGGAGAAGAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 335} {0: 1, 1: 0, 2: 5, 3: 32, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!