ID: 997304637_997304640

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 997304637 997304640
Species Human (GRCh38) Human (GRCh38)
Location 5:132828518-132828540 5:132828531-132828553
Sequence CCTTTCTCTTCCTACTCTTTCTG ACTCTTTCTGAGTCCAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 189, 4: 1469} {0: 1, 1: 0, 2: 1, 3: 21, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!