ID: 997313155_997313160

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 997313155 997313160
Species Human (GRCh38) Human (GRCh38)
Location 5:132907312-132907334 5:132907356-132907378
Sequence CCTATTTTTCATAGAACTTCCCA AGGATGAAACCCAAACTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 285} {0: 1, 1: 0, 2: 1, 3: 21, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!