ID: 997351415_997351417

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 997351415 997351417
Species Human (GRCh38) Human (GRCh38)
Location 5:133233928-133233950 5:133233943-133233965
Sequence CCTTGTTTAGAGCGGGGGTTAGC GGGTTAGCTGACTTTCTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 29} {0: 1, 1: 0, 2: 1, 3: 5, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!