ID: 997351769_997351778

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 997351769 997351778
Species Human (GRCh38) Human (GRCh38)
Location 5:133236175-133236197 5:133236210-133236232
Sequence CCTTGAAGCTGGCCTCAGGCTCT CCTCATCACCACCTGTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 281} {0: 1, 1: 0, 2: 3, 3: 34, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!