ID: 997353557_997353561

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 997353557 997353561
Species Human (GRCh38) Human (GRCh38)
Location 5:133247985-133248007 5:133248003-133248025
Sequence CCACAAGTCTCAGAGTTGGAAGG GAAGGGACCTCCAAGGTCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 229} {0: 1, 1: 0, 2: 0, 3: 29, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!