ID: 997361888_997361892

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 997361888 997361892
Species Human (GRCh38) Human (GRCh38)
Location 5:133300441-133300463 5:133300456-133300478
Sequence CCACTGCCCTTAAATCCCCTACT CCCCTACTGTGCCCTGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 195} {0: 1, 1: 0, 2: 0, 3: 21, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!