ID: 997367817_997367829

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 997367817 997367829
Species Human (GRCh38) Human (GRCh38)
Location 5:133337005-133337027 5:133337043-133337065
Sequence CCCTATCACAGCAACACACCCCT CACCTCTGGCAACTGGGCACAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 26, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!