ID: 997370050_997370056

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 997370050 997370056
Species Human (GRCh38) Human (GRCh38)
Location 5:133353804-133353826 5:133353837-133353859
Sequence CCACGGGCCTCTGGGTTGCAGTG GAGGCCAGTTCTTTGAGCAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 19, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!