ID: 997373565_997373567

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 997373565 997373567
Species Human (GRCh38) Human (GRCh38)
Location 5:133380978-133381000 5:133380993-133381015
Sequence CCCTCAGTAGTTGCAGAAAAAGC GAAAAAGCATTTTGTCAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 177} {0: 1, 1: 2, 2: 5, 3: 37, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!