ID: 997389004_997389007

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 997389004 997389007
Species Human (GRCh38) Human (GRCh38)
Location 5:133498066-133498088 5:133498085-133498107
Sequence CCCATAATATTCTTTAGCACCCC CCCCCCCAATAAATACATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100} {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!