ID: 997456976_997456981

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 997456976 997456981
Species Human (GRCh38) Human (GRCh38)
Location 5:134024946-134024968 5:134024962-134024984
Sequence CCTGGCCAAGCTCCCAGCTGAAG GCTGAAGGCAGCCACATGCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!