ID: 997470627_997470637

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 997470627 997470637
Species Human (GRCh38) Human (GRCh38)
Location 5:134115120-134115142 5:134115154-134115176
Sequence CCGGGGGCCGGCGCCGGGGCCCG AGGTGAGCCCCCGCCGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 89, 4: 621} {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!