|
Left Crispr |
Right Crispr |
| Crispr ID |
997554442 |
997554444 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:134783290-134783312
|
5:134783318-134783340
|
| Sequence |
CCCAGGGTGGAGTGCAGTGGTGC |
CACTGCGCTCACTGTGACCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 447, 1: 48184, 2: 135758, 3: 205238, 4: 192987} |
{0: 1, 1: 0, 2: 2, 3: 12, 4: 219} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|